Postparser v2.3 // project AluCG

You choose CG_Alu_merge / chr3

« List of chromosomes   « View of chromosome

#LengthStrandStartFinishInitial sequence lengthInitial sequence CpGisland
1150-98691649869014180CGAGGTTCCAGTGAGCCGTGACAATGCCACCGCACTCCAACCTAGGTAACAGAGTGAGACCGCCCCCTGTCTGTTAAAAAAAAATCTGTTGGATGCAAGGACAGCTGGCAGGATGAGGGCCTGCCTGCCTGCAGTCTGTGTGTGGAGCCT
AGCGCTGCTCCGACCGCCCTCCGCACCACG
0
2150+98690149869164194CGTGGTGCGGAGGGCGGTCGGAGCAGCGCTAGGCTCCACACACAGACTGCAGGCAGGCAGGCCCTCATCCTGCCAGCTGTCCTTGCATCCAACAGATTTTTTTTTTTAACAGACAGGGGGCGGTCTCACTCTGTTACCTAGGTTGGAGTG
CAGTGGCATTGTCACGGCTCACTGGAACCTCGCTGAGTCGGAGA
0
383+98690119869094102CGTGGTGCGGAGGGCGGTCGCAGCAGCGCTAGGCTCCACACACAGACTGCAGGCAGGCAGGCCCTCATCCTGCCAGCTGTCCTTGCATCCAACAGATTTTTT0
482+98690149869096105CGTGGTGCGGAGGGCGGTCGGAGCAGCGCTAGGCTCCACACACAGACTGCAGGCAGGCAGGCCCTCATCCTGCCAGCTGTCCTTGCATCCAACAGATTTTTTTTA0
582+98690119869093100CGTGGTGCGGAGGCGGTCGCAGCAGCGCTAGGCTCCACACACAGACTGCAGGCAGGCAGGCCCTCATCCTGCCAGCTGTCCTTGCATCCAACAGATTTTT0