Postparser v2.3 // project AluCG

You choose CG_Alu_merge / chr3

« List of chromosomes   « View of chromosome

#LengthStrandStartFinishInitial sequence lengthInitial sequence CpGisland
135-5022172502213759CGTGGTGCGGAGGGCGGTCGGAACCTGCAGGCGGCGAGTGACCCGCCCGCCCTCCTCGG5019876 - 5022223