Postparser v2.3 // project AluCG

You choose CG_Alu_merge / chr17

« List of chromosomes   « View of chromosome

#LengthStrandStartFinishInitial sequence lengthInitial sequence CpGisland
1182+4489584044896022201CGTGGTGCGGAGGGCGGTCGGCGGAGAAACCGGGCCGCGGGCAGACAAGAGGCGAGTCTTACCACCAAATTGGGTAGCCAGCGAGGACCCTGGTGCCACCGAGCAGGAGGCCGAGGAGCAGCCCGAGCAGGTGGGGCTCCATTAGAAGAG
GCGCCGAGGAGGAAGTTTGCCCGCGACCATGAAGAGGGGGAGCGACGCCCC
44895800 - 44897025