Postparser v2.3 // project AluCG

You choose CG_Alu_merge / chr12

« List of chromosomes   « View of chromosome

#LengthStrandStartFinishInitial sequence lengthInitial sequence CpGisland
1353+3448862534488978391CGTGGTGCGGAGGGCGGTCGAATGTGTGGGGTCCGGGGAGTGGCTTGGCCCCTGGGGGCCCCGTCCAAAGCGGCACGGAGGCTTGAAAAGGGGAGGTCGAGTCACCGGCGGAAGGAAAATAAACGGCGCAGCAGAGAAAGGGTCTTGGCC
GCTGGTCAACACCACGCCCCACCTGCCACACATGCTTATGTTTTCTGGGGACCCTGGGGTTCGGGACTTGTGCCCCGGAGTGGCTGGACCTCACAGGGGGCCGCCCAAATGGGCTGGGAGGCTTCAAAGGGGAGTTGAGTCACCAGTGGA
AGGAAAAAAGCCGGCGAGGCAGAGCACAGGTCTTGATCCCTGGCTCCCCCAAGCCTTCCCCGCCACGCATGCGACCGCCCTCCGCACCACG
34488610 - 34489037