Postparser v2.3 // project AluCG

You choose CG_Alu_merge / chr12

« List of chromosomes   « View of chromosome

#LengthStrandStartFinishInitial sequence lengthInitial sequence CpGisland
1518-117477440117476922543CGTGGTGCGGAGGGCGGTCGTCCATGATGAGGACGGGTCCATTAGAGCCCCCAACGTTCTGTGAAGTGGGCGGCACAGGTTGGGGGAAGGGGACTTAATGGGGGTTATGTAATTTGCATGAAAAATCACAGAACCTGAAGTGGTGGGTGA
GATTCAAATGCCTTGGAGCTAAGAGCTTGGATTCAGTACTTAATAATAACTTGCTGTGACAATCTCAGAAAGAATCCAAAATGTCAGAGCCAAATTAACCAGCAAAAAAAGACAGATGGAAGTTTTTCGTCCTCGCTTAGCTCATAGTCT
TGAAACACAGCCCTCTGGTTTTCACCTGCCTGGAACATCACAGTTGGTGGCAGGAGACGATAGGTGGGAAGGGCCGAGGACCGGGGGGCCTGGTCAGGTGTGAGGTGGCGGCGGGAACGTGCCTTAACGCTGCTCCGTCCCTTCCAGATC
TGGCAGGGGATCGACATTGAGACCAAGATGCACGTCCGCTTCCTTAACATGGAAACCATGGCCCTCTGCCACTCGACCCACCGCCACCTCCGA
117476810 - 117477106