Postparser v2.3 // project AluCG

You choose CG_Alu_merge / chr12

« List of chromosomes   « View of chromosome

#LengthStrandStartFinishInitial sequence lengthInitial sequence CpGisland
1326+5785579457856120364CGTGGTGCGGAGGGCGGTCGTGGGCGAGGAGGGGTGTAGCCCCATTTCCTTGGAGGCTCTTCGGCAGCTAGGCAGTGGGGCAGAAAGATGACTGAGTAGGCAAGTTTGGGGGAGTCTCTAGTGTTTGGGGGATCATTTGCAAACTTCCCT
CTTCCCCTGGGTGAGTCATAGAGGGAAGGAGGCGGGAGAATTGTCCCCCCATCCAGCTGCCAACCAGCTGTGCCCCCCGCCCCCAATATTAGTTCCAAGGTCGAGTTGGGTGGTCTTGGATGCGGGATCCGCACCTCGGTTGGAAAAGGA
GGAGTTAGAAAAGGGTACAGCCCAGGCTGCCGGGCCGGGCTGGTCGACCGCCCTCCGCACCACG
0
2216+5785579457856010236CGTGGTGCGGAGGGCGGTCGTGGGCGAGGAGGGGTGTAGCCCCATTTCCTTGGAGGCTCTTCGGCAGCTAGGCAGTGGGGGCAGAAAGATGACTGAGTAGGCAAGTTTGGGGGAGTCTCTAGTGTTTGGGGGATCATTTGCAAACTTCCC
TCCTTCCCCTGGGTGAGTCATAGAGGGAAGGAGGCGGGAGAATTGTCCCCCCATCCAGCTGCCAACCAGCTGTGCCCCCCGCCCCC
0